Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   D9C08_RS05640 Genome accession   NZ_CP032872
Coordinates   1098258..1098380 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain 2KL1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 1093258..1103380
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D9C08_RS05625 (D9C08_05625) yclJ 1094871..1095554 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  D9C08_RS05630 (D9C08_05630) yclK 1095541..1096962 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  D9C08_RS05635 (D9C08_05635) rapC 1097126..1098274 (+) 1149 WP_069837255.1 response regulator aspartate phosphatase RapC Regulator
  D9C08_RS05640 (D9C08_05640) phrC 1098258..1098380 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  D9C08_RS05645 (D9C08_05645) yczM 1098479..1098568 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  D9C08_RS05650 (D9C08_05650) yczN 1098650..1098763 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  D9C08_RS05655 (D9C08_05655) thrD 1098916..1100280 (-) 1365 WP_021481755.1 aspartate kinase -
  D9C08_RS05660 (D9C08_05660) ceuB 1100671..1101621 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  D9C08_RS05665 (D9C08_05665) yclO 1101614..1102561 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  D9C08_RS05670 (D9C08_05670) yclP 1102555..1103313 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=280195 D9C08_RS05640 WP_003224994.1 1098258..1098380(+) (phrC) [Bacillus subtilis subsp. subtilis strain 2KL1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=280195 D9C08_RS05640 WP_003224994.1 1098258..1098380(+) (phrC) [Bacillus subtilis subsp. subtilis strain 2KL1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment