Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   D9C17_RS14535 Genome accession   NZ_CP032863
Coordinates   2702155..2702277 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain N2-2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 2697155..2707277
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D9C17_RS14520 (D9C17_14520) yclJ 2698769..2699452 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  D9C17_RS14525 (D9C17_14525) yclK 2699439..2700860 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  D9C17_RS14530 (D9C17_14530) rapC 2701023..2702171 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  D9C17_RS14535 (D9C17_14535) phrC 2702155..2702277 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  D9C17_RS14540 (D9C17_14540) yczM 2702376..2702465 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  D9C17_RS14545 (D9C17_14545) yczN 2702547..2702660 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  D9C17_RS14550 (D9C17_14550) thrD 2702813..2704177 (-) 1365 WP_014478832.1 aspartate kinase -
  D9C17_RS14555 (D9C17_14555) ceuB 2704568..2705518 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  D9C17_RS14560 (D9C17_14560) yclO 2705511..2706458 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  D9C17_RS14565 (D9C17_14565) yclP 2706452..2707210 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=279801 D9C17_RS14535 WP_003224994.1 2702155..2702277(+) (phrC) [Bacillus subtilis subsp. subtilis strain N2-2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=279801 D9C17_RS14535 WP_003224994.1 2702155..2702277(+) (phrC) [Bacillus subtilis subsp. subtilis strain N2-2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment