Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LLWM1_RS11375 Genome accession   NZ_CP032500
Coordinates   2217182..2217478 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   Q9CDU2
Organism   Lactococcus lactis subsp. lactis strain WM1     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2212182..2222478
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLWM1_RS11340 (LLWM1_2171) - 2212295..2213104 (-) 810 WP_014570791.1 metal ABC transporter permease -
  LLWM1_RS11345 (LLWM1_2172) - 2213097..2213834 (-) 738 WP_058221575.1 metal ABC transporter ATP-binding protein -
  LLWM1_RS11350 (LLWM1_2173) - 2214011..2214853 (-) 843 WP_003129990.1 metal ABC transporter substrate-binding protein -
  LLWM1_RS11355 (LLWM1_2174) - 2214850..2215287 (-) 438 WP_003129992.1 zinc-dependent MarR family transcriptional regulator -
  LLWM1_RS11360 (LLWM1_2175) - 2215494..2216441 (+) 948 WP_003130410.1 IS30 family transposase -
  LLWM1_RS11365 (LLWM1_2176) comGG 2216415..2216741 (-) 327 WP_058221568.1 competence type IV pilus minor pilin ComGG Machinery gene
  LLWM1_RS11370 (LLWM1_2177) comGF 2216791..2217219 (-) 429 Protein_2212 competence type IV pilus minor pilin ComGF -
  LLWM1_RS11375 (LLWM1_2178) comGE 2217182..2217478 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  LLWM1_RS11380 (LLWM1_2179) comGD 2217450..2217881 (-) 432 WP_080585155.1 competence type IV pilus minor pilin ComGD Machinery gene
  LLWM1_RS11385 (LLWM1_2180) comGC 2217841..2218110 (-) 270 WP_003129998.1 competence type IV pilus major pilin ComGC Machinery gene
  LLWM1_RS11390 (LLWM1_2181) - 2218237..2218929 (-) 693 WP_152994386.1 hypothetical protein -
  LLWM1_RS11395 (LLWM1_2182) - 2219171..2219950 (-) 780 WP_082225220.1 peptidoglycan amidohydrolase family protein -
  LLWM1_RS11400 (LLWM1_2183) - 2219950..2220249 (-) 300 WP_031559226.1 phage holin -
  LLWM1_RS11405 (LLWM1_2184) - 2220262..2220612 (-) 351 WP_014570798.1 hypothetical protein -
  LLWM1_RS11410 (LLWM1_2185) - 2220625..2220861 (-) 237 WP_082225257.1 hypothetical protein -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=276412 LLWM1_RS11375 WP_010906316.1 2217182..2217478(-) (comGE) [Lactococcus lactis subsp. lactis strain WM1]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=276412 LLWM1_RS11375 WP_010906316.1 2217182..2217478(-) (comGE) [Lactococcus lactis subsp. lactis strain WM1]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterProScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q9CDU2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673