Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   C2I05_RS13100 Genome accession   NZ_CP026039
Coordinates   2474587..2474709 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PK1_2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2469587..2479709
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C2I05_RS13085 (C2I05_13065) yclJ 2471201..2471884 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  C2I05_RS13090 (C2I05_13070) yclK 2471871..2473292 (+) 1422 WP_080121165.1 two-component system sensor histidine kinase YclK -
  C2I05_RS13095 (C2I05_13075) rapC 2473455..2474603 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  C2I05_RS13100 (C2I05_13080) phrC 2474587..2474709 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C2I05_RS13105 (C2I05_13085) yczM 2474809..2474898 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  C2I05_RS13110 (C2I05_13090) yczN 2474980..2475093 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  C2I05_RS13115 (C2I05_13095) thrD 2475246..2476610 (-) 1365 WP_120027774.1 aspartate kinase -
  C2I05_RS13120 (C2I05_13100) ceuB 2476995..2477945 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C2I05_RS13125 (C2I05_13105) yclO 2477938..2478885 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  C2I05_RS13130 (C2I05_13110) yclP 2478879..2479637 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=265868 C2I05_RS13100 WP_003224994.1 2474587..2474709(+) (phrC) [Bacillus subtilis strain PK1_2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=265868 C2I05_RS13100 WP_003224994.1 2474587..2474709(+) (phrC) [Bacillus subtilis strain PK1_2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment