Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   C2H97_RS11090 Genome accession   NZ_CP026038
Coordinates   2123858..2123980 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis PY79 strain PK1_3     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2118858..2128980
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C2H97_RS11075 (C2H97_11100) yclJ 2120472..2121155 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  C2H97_RS11080 (C2H97_11105) yclK 2121142..2122563 (+) 1422 WP_080121165.1 two-component system sensor histidine kinase YclK -
  C2H97_RS11085 (C2H97_11110) rapC 2122726..2123874 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  C2H97_RS11090 (C2H97_11115) phrC 2123858..2123980 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C2H97_RS11095 (C2H97_11120) yczM 2124080..2124169 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  C2H97_RS11100 (C2H97_11125) yczN 2124251..2124364 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  C2H97_RS11105 (C2H97_11130) thrD 2124517..2125881 (-) 1365 WP_120027774.1 aspartate kinase -
  C2H97_RS11110 (C2H97_11135) ceuB 2126266..2127216 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C2H97_RS11115 (C2H97_11140) yclO 2127209..2128156 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  C2H97_RS11120 (C2H97_11145) yclP 2128150..2128908 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=265787 C2H97_RS11090 WP_003224994.1 2123858..2123980(+) (phrC) [Bacillus subtilis PY79 strain PK1_3]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=265787 C2H97_RS11090 WP_003224994.1 2123858..2123980(+) (phrC) [Bacillus subtilis PY79 strain PK1_3]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment