Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   C2H96_RS09220 Genome accession   NZ_CP026035
Coordinates   1818743..1818865 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PK5_68     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 1813743..1823865
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C2H96_RS09190 (C2H96_09120) yclP 1813815..1814573 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  C2H96_RS09195 (C2H96_09125) yclO 1814567..1815514 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  C2H96_RS09200 (C2H96_09130) ceuB 1815507..1816457 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C2H96_RS09205 (C2H96_09135) thrD 1816842..1818206 (+) 1365 WP_120027774.1 aspartate kinase -
  C2H96_RS09210 (C2H96_09140) yczN 1818359..1818472 (+) 114 WP_032678937.1 YjcZ family sporulation protein -
  C2H96_RS09215 (C2H96_09145) yczM 1818554..1818643 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  C2H96_RS09220 (C2H96_09150) phrC 1818743..1818865 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C2H96_RS09225 (C2H96_09155) rapC 1818849..1819997 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  C2H96_RS09230 (C2H96_09160) yclK 1820160..1821581 (-) 1422 WP_080121165.1 two-component system sensor histidine kinase YclK -
  C2H96_RS09235 (C2H96_09165) yclJ 1821568..1822251 (-) 684 WP_015482792.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=265530 C2H96_RS09220 WP_003224994.1 1818743..1818865(-) (phrC) [Bacillus subtilis strain PK5_68]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=265530 C2H96_RS09220 WP_003224994.1 1818743..1818865(-) (phrC) [Bacillus subtilis strain PK5_68]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment