Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   C2H94_RS12500 Genome accession   NZ_CP026034
Coordinates   2379220..2379342 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PK5_52     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2374220..2384342
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C2H94_RS12485 (C2H94_12430) yclJ 2375834..2376517 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  C2H94_RS12490 (C2H94_12435) yclK 2376504..2377925 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  C2H94_RS12495 (C2H94_12440) rapC 2378088..2379236 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  C2H94_RS12500 (C2H94_12445) phrC 2379220..2379342 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C2H94_RS12505 (C2H94_12450) yczM 2379442..2379531 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  C2H94_RS12510 (C2H94_12455) yczN 2379613..2379726 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  C2H94_RS12515 (C2H94_12460) thrD 2379878..2381242 (-) 1365 WP_072173982.1 aspartate kinase -
  C2H94_RS12520 (C2H94_12465) ceuB 2381627..2382577 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C2H94_RS12525 (C2H94_12470) yclO 2382570..2383517 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  C2H94_RS12530 (C2H94_12475) yclP 2383511..2384269 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=265476 C2H94_RS12500 WP_003224994.1 2379220..2379342(+) (phrC) [Bacillus subtilis strain PK5_52]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=265476 C2H94_RS12500 WP_003224994.1 2379220..2379342(+) (phrC) [Bacillus subtilis strain PK5_52]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment