Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   C2H91_RS08035 Genome accession   NZ_CP026030
Coordinates   1636503..1636625 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PK3_9     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1631503..1641625
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C2H91_RS08005 (C2H91_08010) yclP 1631575..1632333 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  C2H91_RS08010 (C2H91_08015) yclO 1632327..1633274 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  C2H91_RS08015 (C2H91_08020) ceuB 1633267..1634217 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C2H91_RS08020 (C2H91_08025) thrD 1634602..1635966 (+) 1365 WP_032726529.1 aspartate kinase -
  C2H91_RS08025 (C2H91_08030) yczN 1636119..1636232 (+) 114 WP_032678937.1 YjcZ family sporulation protein -
  C2H91_RS08030 (C2H91_08035) yczM 1636314..1636403 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  C2H91_RS08035 (C2H91_08040) phrC 1636503..1636625 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C2H91_RS08040 (C2H91_08045) rapC 1636609..1637757 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  C2H91_RS08045 (C2H91_08050) yclK 1637921..1639342 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  C2H91_RS08050 (C2H91_08055) yclJ 1639329..1640012 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=265263 C2H91_RS08035 WP_003224994.1 1636503..1636625(-) (phrC) [Bacillus subtilis strain PK3_9]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=265263 C2H91_RS08035 WP_003224994.1 1636503..1636625(-) (phrC) [Bacillus subtilis strain PK3_9]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCTGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment