Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   DJ572_RS01700 Genome accession   NZ_CP029461
Coordinates   338931..339053 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain QB61     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 333931..344053
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  DJ572_RS01685 (DJ572_01680) yclJ 335545..336228 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  DJ572_RS01690 (DJ572_01685) yclK 336215..337636 (+) 1422 WP_119899021.1 two-component system sensor histidine kinase YclK -
  DJ572_RS01695 (DJ572_01690) rapC 337799..338947 (+) 1149 WP_119899023.1 response regulator aspartate phosphatase RapC Regulator
  DJ572_RS01700 (DJ572_01695) phrC 338931..339053 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  DJ572_RS01705 (DJ572_01700) yczM 339153..339242 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  DJ572_RS01710 (DJ572_01705) yczN 339324..339437 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  DJ572_RS01715 (DJ572_01710) thrD 339591..340955 (-) 1365 WP_038428355.1 aspartate kinase -
  DJ572_RS01720 (DJ572_01715) ceuB 341340..342290 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  DJ572_RS01725 (DJ572_01720) yclO 342283..343230 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  DJ572_RS01730 (DJ572_01725) yclP 343224..343982 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=253313 DJ572_RS01700 WP_003224994.1 338931..339053(+) (phrC) [Bacillus subtilis strain QB61]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=253313 DJ572_RS01700 WP_003224994.1 338931..339053(+) (phrC) [Bacillus subtilis strain QB61]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1