Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   CJZ71_RS14400 Genome accession   NZ_CP022891
Coordinates   2727306..2727428 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain DKU_NT_03     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2722306..2732428
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  CJZ71_RS14385 (CJZ71_14385) yclJ 2723919..2724602 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  CJZ71_RS14390 (CJZ71_14390) yclK 2724589..2726010 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  CJZ71_RS14395 (CJZ71_14395) rapC 2726174..2727322 (+) 1149 WP_069837255.1 response regulator aspartate phosphatase RapC Regulator
  CJZ71_RS14400 (CJZ71_14400) phrC 2727306..2727428 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  CJZ71_RS14405 (CJZ71_14405) yczM 2727527..2727616 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  CJZ71_RS14410 (CJZ71_14410) yczN 2727698..2727811 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  CJZ71_RS14415 (CJZ71_14415) thrD 2727964..2729328 (-) 1365 WP_021481755.1 aspartate kinase -
  CJZ71_RS14420 (CJZ71_14420) ceuB 2729719..2730669 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  CJZ71_RS14425 (CJZ71_14425) yclO 2730662..2731609 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  CJZ71_RS14430 (CJZ71_14430) yclP 2731603..2732361 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=242651 CJZ71_RS14400 WP_003224994.1 2727306..2727428(+) (phrC) [Bacillus subtilis strain DKU_NT_03]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=242651 CJZ71_RS14400 WP_003224994.1 2727306..2727428(+) (phrC) [Bacillus subtilis strain DKU_NT_03]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment