Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   CJZ70_RS18075 Genome accession   NZ_CP022890
Coordinates   3417902..3418024 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain DKU_NT_02     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3412902..3423024
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  CJZ70_RS18045 (CJZ70_18045) yclP 3412969..3413727 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  CJZ70_RS18050 (CJZ70_18050) yclO 3413721..3414668 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  CJZ70_RS18055 (CJZ70_18055) ceuB 3414661..3415611 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  CJZ70_RS18060 (CJZ70_18060) thrD 3416002..3417366 (+) 1365 WP_021481755.1 aspartate kinase -
  CJZ70_RS18065 (CJZ70_18065) yczN 3417519..3417632 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  CJZ70_RS18070 (CJZ70_18070) yczM 3417714..3417803 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  CJZ70_RS18075 (CJZ70_18075) phrC 3417902..3418024 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  CJZ70_RS18080 (CJZ70_18080) rapC 3418008..3419156 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  CJZ70_RS18085 (CJZ70_18085) yclK 3419320..3420741 (-) 1422 WP_080317125.1 two-component system sensor histidine kinase YclK -
  CJZ70_RS18090 (CJZ70_18090) yclJ 3420728..3421411 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=242584 CJZ70_RS18075 WP_003224994.1 3417902..3418024(-) (phrC) [Bacillus subtilis strain DKU_NT_02]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=242584 CJZ70_RS18075 WP_003224994.1 3417902..3418024(-) (phrC) [Bacillus subtilis strain DKU_NT_02]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment