Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   S101441_RS02255 Genome accession   NZ_CP021507
Coordinates   464495..464617 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain SRCM101441     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 459495..469617
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  S101441_RS02240 (S101441_00448) yclJ 461108..461791 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  S101441_RS02245 (S101441_00449) yclK 461778..463199 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  S101441_RS02250 (S101441_00450) rapC 463363..464511 (+) 1149 WP_069837255.1 response regulator aspartate phosphatase RapC Regulator
  S101441_RS02255 (S101441_00451) phrC 464495..464617 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  S101441_RS02260 yczM 464716..464805 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  S101441_RS02265 (S101441_00452) yczN 464887..465000 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  S101441_RS02270 (S101441_00453) thrD 465153..466517 (-) 1365 WP_021481755.1 aspartate kinase -
  S101441_RS02275 (S101441_00455) ceuB 466908..467858 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  S101441_RS02280 (S101441_00456) yclO 467851..468798 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  S101441_RS02285 (S101441_00457) yclP 468792..469550 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=231444 S101441_RS02255 WP_003224994.1 464495..464617(+) (phrC) [Bacillus subtilis subsp. subtilis strain SRCM101441]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=231444 S101441_RS02255 WP_003224994.1 464495..464617(+) (phrC) [Bacillus subtilis subsp. subtilis strain SRCM101441]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment