Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   CAH07_RS19270 Genome accession   NZ_CP021123
Coordinates   3691281..3691403 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SEM-9     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3686281..3696403
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  CAH07_RS19240 (CAH07_19060) yclP 3686352..3687110 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  CAH07_RS19245 (CAH07_19065) yclO 3687104..3688051 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  CAH07_RS19250 (CAH07_19070) ceuB 3688044..3688994 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  CAH07_RS19255 (CAH07_19075) thrD 3689379..3690743 (+) 1365 WP_038428355.1 aspartate kinase -
  CAH07_RS19260 (CAH07_19080) yczN 3690897..3691010 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  CAH07_RS19265 (CAH07_19085) yczM 3691092..3691181 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  CAH07_RS19270 (CAH07_19090) phrC 3691281..3691403 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  CAH07_RS19275 (CAH07_19095) rapC 3691387..3692535 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  CAH07_RS19280 (CAH07_19100) yclK 3692699..3694120 (-) 1422 WP_101172129.1 two-component system sensor histidine kinase YclK -
  CAH07_RS19285 (CAH07_19105) yclJ 3694107..3694790 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=228424 CAH07_RS19270 WP_003224994.1 3691281..3691403(-) (phrC) [Bacillus subtilis strain SEM-9]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=228424 CAH07_RS19270 WP_003224994.1 3691281..3691403(-) (phrC) [Bacillus subtilis strain SEM-9]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment