Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   B9L64_RS15385 Genome accession   NZ_CP020915
Coordinates   3004286..3004408 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain 50-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2999286..3009408
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  B9L64_RS15370 yclJ 3000899..3001582 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  B9L64_RS15375 yclK 3001569..3002990 (+) 1422 WP_080479511.1 two-component system sensor histidine kinase YclK -
  B9L64_RS15380 rapC 3003154..3004302 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  B9L64_RS15385 phrC 3004286..3004408 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  B9L64_RS15390 yczM 3004508..3004597 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  B9L64_RS15395 yczN 3004679..3004792 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  B9L64_RS15400 thrD 3004946..3006310 (-) 1365 WP_110109576.1 aspartate kinase -
  B9L64_RS15405 ceuB 3006695..3007645 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  B9L64_RS15410 yclO 3007638..3008585 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  B9L64_RS15415 yclP 3008579..3009337 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=227105 B9L64_RS15385 WP_003224994.1 3004286..3004408(+) (phrC) [Bacillus subtilis strain 50-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=227105 B9L64_RS15385 WP_003224994.1 3004286..3004408(+) (phrC) [Bacillus subtilis strain 50-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment