Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   BS21228_RS14400 Genome accession   NZ_CP020023
Coordinates   2705587..2705709 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain ATCC 21228     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 2700587..2710709
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BS21228_RS14385 (BS21228_14350) yclJ 2702201..2702884 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  BS21228_RS14390 (BS21228_14355) yclK 2702871..2704292 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  BS21228_RS14395 (BS21228_14360) rapC 2704455..2705603 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BS21228_RS14400 (BS21228_14365) phrC 2705587..2705709 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BS21228_RS14405 (BS21228_14370) yczM 2705808..2705897 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BS21228_RS14410 (BS21228_14375) yczN 2705979..2706092 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  BS21228_RS14415 (BS21228_14380) thrD 2706245..2707609 (-) 1365 WP_014478832.1 aspartate kinase -
  BS21228_RS14420 (BS21228_14385) ceuB 2708000..2708950 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  BS21228_RS14425 (BS21228_14390) yclO 2708943..2709890 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  BS21228_RS14430 (BS21228_14395) yclP 2709884..2710642 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=220351 BS21228_RS14400 WP_003224994.1 2705587..2705709(+) (phrC) [Bacillus subtilis strain ATCC 21228]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=220351 BS21228_RS14400 WP_003224994.1 2705587..2705709(+) (phrC) [Bacillus subtilis strain ATCC 21228]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment