Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   BKP58_RS10160 Genome accession   NZ_CP017763
Coordinates   1858525..1858647 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain 29R7-12     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 1853525..1863647
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BKP58_RS10130 (BKP58_10140) yclP 1853592..1854350 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  BKP58_RS10135 (BKP58_10145) yclO 1854344..1855291 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  BKP58_RS10140 (BKP58_10150) ceuB 1855284..1856234 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  BKP58_RS10145 (BKP58_10155) thrD 1856625..1857989 (+) 1365 WP_014478832.1 aspartate kinase -
  BKP58_RS10150 (BKP58_10160) yczN 1858142..1858255 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  BKP58_RS10155 yczM 1858337..1858426 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  BKP58_RS10160 (BKP58_10165) phrC 1858525..1858647 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BKP58_RS10165 (BKP58_10170) rapC 1858631..1859779 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BKP58_RS10170 (BKP58_10175) yclK 1859942..1861363 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  BKP58_RS10175 (BKP58_10180) yclJ 1861350..1862033 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=202663 BKP58_RS10160 WP_003224994.1 1858525..1858647(-) (phrC) [Bacillus subtilis strain 29R7-12]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=202663 BKP58_RS10160 WP_003224994.1 1858525..1858647(-) (phrC) [Bacillus subtilis strain 29R7-12]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment