Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   BSSX_RS02135 Genome accession   NZ_CP022287
Coordinates   421165..421287 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SX01705     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 416165..426287
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BSSX_RS02120 (BSSX_0436) yclJ 417778..418461 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  BSSX_RS02125 (BSSX_0437) yclK 418448..419869 (+) 1422 WP_080030630.1 two-component system sensor histidine kinase YclK -
  BSSX_RS02130 (BSSX_0439) rapC 420033..421181 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BSSX_RS02135 (BSSX_0440) phrC 421165..421287 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BSSX_RS02140 (BSSX_0441) yczM 421387..421476 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BSSX_RS02145 (BSSX_0442) yczN 421558..421671 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  BSSX_RS02150 (BSSX_0443) thrD 421824..423188 (-) 1365 WP_015382767.1 aspartate kinase -
  BSSX_RS02155 (BSSX_0445) ceuB 423573..424523 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  BSSX_RS02160 (BSSX_0446) yclO 424516..425463 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  BSSX_RS02165 (BSSX_0447) yclP 425457..426215 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=200046 BSSX_RS02135 WP_003224994.1 421165..421287(+) (phrC) [Bacillus subtilis strain SX01705]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=200046 BSSX_RS02135 WP_003224994.1 421165..421287(+) (phrC) [Bacillus subtilis strain SX01705]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment