Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   BSBS38_RS02170 Genome accession   NZ_CP017314
Coordinates   426656..426778 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain BS38     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 421656..431778
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BSBS38_RS02155 (BSBS38_00432) yclJ 423270..423953 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  BSBS38_RS02160 (BSBS38_00433) yclK 423940..425361 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  BSBS38_RS02165 (BSBS38_00434) rapC 425524..426672 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BSBS38_RS02170 (BSBS38_00435) phrC 426656..426778 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BSBS38_RS21305 yczM 426877..426966 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BSBS38_RS02175 (BSBS38_00436) yczN 427048..427161 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  BSBS38_RS02180 (BSBS38_00437) thrD 427314..428678 (-) 1365 WP_021481755.1 aspartate kinase -
  BSBS38_RS02185 (BSBS38_00439) ceuB 429069..430019 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  BSBS38_RS02190 (BSBS38_00440) yclO 430012..430959 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  BSBS38_RS02195 (BSBS38_00441) yclP 430953..431711 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=197594 BSBS38_RS02170 WP_003224994.1 426656..426778(+) (phrC) [Bacillus subtilis strain BS38]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=197594 BSBS38_RS02170 WP_003224994.1 426656..426778(+) (phrC) [Bacillus subtilis strain BS38]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment