Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   BS16045_RS02190 Genome accession   NZ_CP017112
Coordinates   429418..429540 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain BS16045     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424418..434540
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BS16045_RS02175 (BS16045_00425) yclJ 426031..426714 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  BS16045_RS02180 (BS16045_00426) yclK 426701..428122 (+) 1422 WP_080479511.1 two-component system sensor histidine kinase YclK -
  BS16045_RS02185 (BS16045_00427) rapC 428286..429434 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  BS16045_RS02190 (BS16045_00428) phrC 429418..429540 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BS16045_RS21770 (BS16045_00429) yczM 429640..429729 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BS16045_RS02195 (BS16045_00430) yczN 429811..429924 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  BS16045_RS02200 (BS16045_00431) thrD 430078..431442 (-) 1365 WP_003234493.1 aspartate kinase -
  BS16045_RS02205 (BS16045_00432) ceuB 431827..432777 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  BS16045_RS02210 (BS16045_00433) yclO 432770..433717 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  BS16045_RS02215 (BS16045_00434) yclP 433711..434469 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=195665 BS16045_RS02190 WP_003224994.1 429418..429540(+) (phrC) [Bacillus subtilis strain BS16045]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=195665 BS16045_RS02190 WP_003224994.1 429418..429540(+) (phrC) [Bacillus subtilis strain BS16045]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment