Detailed information    

insolico Bioinformatically predicted

Overview

Name   pilJ   Type   Machinery gene
Locus tag   ABE28_RS25960 Genome accession   NZ_CP017080
Coordinates   2195162..2195263 (+) Length   33 a.a.
NCBI ID   WP_306807339.1    Uniprot ID   -
Organism   Peribacillus muralis strain G25-68     
Function   type IV pilus biogenesis and function (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2190162..2200263
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ABE28_RS10710 (ABE28_010710) - 2191093..2191626 (+) 534 WP_064465217.1 TlpA disulfide reductase family protein -
  ABE28_RS24485 - 2191878..2192006 (+) 129 WP_081092343.1 FbpB family small basic protein -
  ABE28_RS10715 (ABE28_010715) - 2192132..2192275 (+) 144 WP_064465216.1 acid-soluble spore protein N -
  ABE28_RS10720 (ABE28_010720) tlp 2192341..2192574 (+) 234 WP_064465215.1 small acid-soluble spore protein Tlp -
  ABE28_RS10725 (ABE28_010725) - 2192715..2193146 (+) 432 WP_064465340.1 thioesterase family protein -
  ABE28_RS10730 (ABE28_010730) - 2193167..2193463 (+) 297 WP_064465214.1 hypothetical protein -
  ABE28_RS10735 (ABE28_010735) - 2193502..2193798 (-) 297 WP_064465213.1 HesB/YadR/YfhF family protein -
  ABE28_RS10740 (ABE28_010740) - 2193888..2194376 (+) 489 WP_064465212.1 8-oxo-dGTP diphosphatase -
  ABE28_RS10745 (ABE28_010745) - 2194643..2194792 (-) 150 WP_064505153.1 YycC family protein -
  ABE28_RS25960 pilJ 2195162..2195263 (+) 102 WP_306807339.1 methyl-accepting chemotaxis protein Machinery gene
  ABE28_RS10750 (ABE28_010750) - 2195387..2195593 (+) 207 WP_064465211.1 hypothetical protein -
  ABE28_RS10755 (ABE28_010755) plsY 2195643..2196233 (-) 591 WP_064465210.1 glycerol-3-phosphate 1-O-acyltransferase PlsY -
  ABE28_RS10760 (ABE28_010760) - 2196664..2197074 (+) 411 WP_064465209.1 CoA-binding protein -
  ABE28_RS10765 (ABE28_010765) parE 2197460..2199445 (+) 1986 WP_064465208.1 DNA topoisomerase IV subunit B -

Sequence

Protein


Download         Length: 33 a.a.        Molecular weight: 3372.78 Da        Isoelectric Point: 3.8195

>NTDB_id=195313 ABE28_RS25960 WP_306807339.1 2195162..2195263(+) (pilJ) [Peribacillus muralis strain G25-68]
MQEIAGQTNLLSLNSAIEAARAGENGMGCSCCE

Nucleotide


Download         Length: 102 bp        

>NTDB_id=195313 ABE28_RS25960 WP_306807339.1 2195162..2195263(+) (pilJ) [Peribacillus muralis strain G25-68]
GTGCAGGAAATAGCCGGCCAAACCAATCTGCTGTCATTGAATTCCGCCATCGAGGCTGCCCGTGCAGGTGAAAATGGCAT
GGGTTGCAGTTGTTGCGAATGA

Domains

Predicted by InterProScan.

Methyl-accepting chemotaxis protein (MCP) signalling domain (MCPsignal)

(2-30)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  pilJ Synechocystis sp. PCC 6803

53.125

96.97

0.515

Multiple sequence alignment