Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   BGM23_RS19965 Genome accession   NZ_CP017072
Coordinates   3842582..3842704 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. FJAT-14266     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 3837582..3847704
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BGM23_RS19940 (BGM23_19940) yclP 3837654..3838412 (-) 759 WP_046664285.1 petrobactin ABC transporter ATP-binding protein YclP -
  BGM23_RS19945 (BGM23_19945) yclO 3838406..3839353 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  BGM23_RS19950 (BGM23_19950) ceuB 3839346..3840296 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  BGM23_RS19955 (BGM23_19955) - 3840681..3842045 (+) 1365 WP_015715246.1 aspartate kinase -
  BGM23_RS19960 (BGM23_19960) - 3842198..3842311 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  BGM23_RS21670 - 3842393..3842482 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  BGM23_RS19965 (BGM23_19965) phrC 3842582..3842704 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BGM23_RS19970 (BGM23_19970) rapC 3842688..3843836 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BGM23_RS19975 (BGM23_19975) yclK 3843999..3845420 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  BGM23_RS19980 (BGM23_19980) yclJ 3845407..3846090 (-) 684 WP_032722955.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=195226 BGM23_RS19965 WP_003224994.1 3842582..3842704(-) (phrC) [Bacillus sp. FJAT-14266]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=195226 BGM23_RS19965 WP_003224994.1 3842582..3842704(-) (phrC) [Bacillus sp. FJAT-14266]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment