Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   BSHJ0_RS02175 Genome accession   NZ_CP016894
Coordinates   428177..428299 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain HJ0-6     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 423177..433299
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BSHJ0_RS02160 (BSHJ0_00422) yclJ 424791..425474 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  BSHJ0_RS02165 (BSHJ0_00423) yclK 425461..426882 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  BSHJ0_RS02170 (BSHJ0_00424) rapC 427045..428193 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BSHJ0_RS02175 (BSHJ0_00425) phrC 428177..428299 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BSHJ0_RS22175 yczM 428399..428488 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BSHJ0_RS02180 (BSHJ0_00426) yczN 428570..428683 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  BSHJ0_RS02185 (BSHJ0_00427) thrD 428836..430200 (-) 1365 WP_029726569.1 aspartate kinase -
  BSHJ0_RS02190 (BSHJ0_00428) ceuB 430585..431535 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  BSHJ0_RS02195 (BSHJ0_00429) yclO 431528..432475 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  BSHJ0_RS02200 (BSHJ0_00430) yclP 432469..433227 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=193418 BSHJ0_RS02175 WP_003224994.1 428177..428299(+) (phrC) [Bacillus subtilis strain HJ0-6]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=193418 BSHJ0_RS02175 WP_003224994.1 428177..428299(+) (phrC) [Bacillus subtilis strain HJ0-6]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment