Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   S101444_RS02180 Genome accession   NZ_CP021498
Coordinates   427214..427336 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain SRCM101444     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 422214..432336
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  S101444_RS02165 (S101444_00421) yclJ 423828..424511 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  S101444_RS02170 (S101444_00422) yclK 424498..425919 (+) 1422 WP_080348068.1 two-component system sensor histidine kinase YclK -
  S101444_RS02175 (S101444_00423) rapC 426082..427230 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  S101444_RS02180 (S101444_00424) phrC 427214..427336 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  S101444_RS02185 yczM 427436..427525 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  S101444_RS02190 (S101444_00425) yczN 427607..427720 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  S101444_RS02195 (S101444_00426) thrD 427873..429237 (-) 1365 WP_029726569.1 aspartate kinase -
  S101444_RS02200 (S101444_00427) ceuB 429622..430572 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  S101444_RS02205 (S101444_00428) yclO 430565..431512 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  S101444_RS02210 (S101444_00429) yclP 431506..432264 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=193161 S101444_RS02180 WP_003224994.1 427214..427336(+) (phrC) [Bacillus subtilis subsp. subtilis strain SRCM101444]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=193161 S101444_RS02180 WP_003224994.1 427214..427336(+) (phrC) [Bacillus subtilis subsp. subtilis strain SRCM101444]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment