Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   A8O17_RS02095 Genome accession   NZ_CP015975
Coordinates   411930..412052 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain delta6     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 406930..417052
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  A8O17_RS02080 (A8O17_02080) yclJ 408544..409227 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  A8O17_RS02085 (A8O17_02085) yclK 409214..410635 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  A8O17_RS02090 (A8O17_02090) rapC 410798..411946 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  A8O17_RS02095 (A8O17_02095) phrC 411930..412052 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  A8O17_RS20345 yczM 412152..412241 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  A8O17_RS02100 (A8O17_02100) yczN 412323..412436 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  A8O17_RS02105 (A8O17_02105) thrD 412590..413954 (-) 1365 WP_009966541.1 aspartate kinase -
  A8O17_RS02110 (A8O17_02110) ceuB 414339..415289 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  A8O17_RS02115 (A8O17_02115) yclO 415282..416229 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  A8O17_RS02120 (A8O17_02120) yclP 416223..416981 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=184855 A8O17_RS02095 WP_003224994.1 411930..412052(+) (phrC) [Bacillus subtilis subsp. subtilis strain delta6]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=184855 A8O17_RS02095 WP_003224994.1 411930..412052(+) (phrC) [Bacillus subtilis subsp. subtilis strain delta6]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment