Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   AS891_RS22045 Genome accession   NZ_CP015375
Coordinates   4177756..4177878 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain KCTC 3135     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 4172756..4182878
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AS891_RS22020 (AS891_22015) yclP 4172827..4173585 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  AS891_RS22025 (AS891_22020) yclO 4173579..4174526 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  AS891_RS22030 (AS891_22025) ceuB 4174519..4175469 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  AS891_RS22035 (AS891_22030) thrD 4175854..4177218 (+) 1365 WP_003234493.1 aspartate kinase -
  AS891_RS22040 (AS891_22035) yczN 4177372..4177485 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  AS891_RS22690 yczM 4177567..4177656 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  AS891_RS22045 (AS891_22040) phrC 4177756..4177878 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AS891_RS22050 (AS891_22045) rapC 4177862..4179010 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  AS891_RS22055 (AS891_22050) yclK 4179173..4180594 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  AS891_RS22060 (AS891_22055) yclJ 4180581..4181264 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=178956 AS891_RS22045 WP_003224994.1 4177756..4177878(-) (phrC) [Bacillus subtilis subsp. subtilis strain KCTC 3135]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=178956 AS891_RS22045 WP_003224994.1 4177756..4177878(-) (phrC) [Bacillus subtilis subsp. subtilis strain KCTC 3135]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment