Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   A4A60_RS02220 Genome accession   NZ_CP015222
Coordinates   468406..468528 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain HRBS-10TDI13     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 463406..473528
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  A4A60_RS02205 (A4A60_02210) yclJ 465019..465702 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  A4A60_RS02210 (A4A60_02215) yclK 465689..467110 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  A4A60_RS02215 (A4A60_02220) rapC 467274..468422 (+) 1149 WP_069837255.1 response regulator aspartate phosphatase RapC Regulator
  A4A60_RS02220 (A4A60_02225) phrC 468406..468528 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  A4A60_RS22305 yczM 468627..468716 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  A4A60_RS02225 (A4A60_02230) yczN 468798..468911 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  A4A60_RS02230 (A4A60_02235) thrD 469064..470428 (-) 1365 WP_021481755.1 aspartate kinase -
  A4A60_RS02235 (A4A60_02240) ceuB 470819..471769 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  A4A60_RS02240 (A4A60_02245) yclO 471762..472709 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  A4A60_RS02245 (A4A60_02250) yclP 472703..473461 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=177626 A4A60_RS02220 WP_003224994.1 468406..468528(+) (phrC) [Bacillus subtilis strain HRBS-10TDI13]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=177626 A4A60_RS02220 WP_003224994.1 468406..468528(+) (phrC) [Bacillus subtilis strain HRBS-10TDI13]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment