Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   BFI33_RS02190 Genome accession   NZ_CP016852
Coordinates   429425..429547 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain 168G     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424425..434547
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BFI33_RS02175 (BFI33_02175) yclJ 426039..426722 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  BFI33_RS02180 (BFI33_02180) yclK 426709..428130 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  BFI33_RS02185 (BFI33_02185) rapC 428293..429441 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  BFI33_RS02190 (BFI33_02190) phrC 429425..429547 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BFI33_RS22210 yczM 429647..429736 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BFI33_RS02195 (BFI33_02195) yczN 429818..429931 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  BFI33_RS02200 (BFI33_02200) thrD 430085..431449 (-) 1365 WP_009966541.1 aspartate kinase -
  BFI33_RS02205 (BFI33_02205) ceuB 431834..432784 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  BFI33_RS02210 (BFI33_02210) yclO 432777..433724 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  BFI33_RS02215 (BFI33_02215) yclP 433718..434476 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=164010 BFI33_RS02190 WP_003224994.1 429425..429547(+) (phrC) [Bacillus subtilis subsp. subtilis strain 168G]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=164010 BFI33_RS02190 WP_003224994.1 429425..429547(+) (phrC) [Bacillus subtilis subsp. subtilis strain 168G]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1