Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   O7A_RS02185 Genome accession   NZ_CP011115
Coordinates   429960..430082 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis KCTC 1028 = ATCC 6051a strain KCTC 1028     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424960..435082
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  O7A_RS02170 (O7A_02170) yclJ 426574..427257 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  O7A_RS02175 (O7A_02175) yclK 427244..428665 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  O7A_RS02180 (O7A_02180) rapC 428828..429976 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  O7A_RS02185 (O7A_02185) phrC 429960..430082 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  O7A_RS22255 (O7A_02190) yczM 430182..430271 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  O7A_RS22260 (O7A_02195) yczN 430353..430466 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  O7A_RS02200 (O7A_02200) thrD 430620..431984 (-) 1365 WP_003234493.1 aspartate kinase -
  O7A_RS02205 (O7A_02205) ceuB 432369..433319 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  O7A_RS02210 (O7A_02210) yclO 433312..434259 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  O7A_RS02215 (O7A_02215) yclP 434253..435011 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=142408 O7A_RS02185 WP_003224994.1 429960..430082(+) (phrC) [Bacillus subtilis KCTC 1028 = ATCC 6051a strain KCTC 1028]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=142408 O7A_RS02185 WP_003224994.1 429960..430082(+) (phrC) [Bacillus subtilis KCTC 1028 = ATCC 6051a strain KCTC 1028]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment