Detailed information
Overview
| Name | phrC | Type | Regulator |
| Locus tag | RP72_RS02185 | Genome accession | NZ_CP010314 |
| Coordinates | 429961..430083 (+) | Length | 40 a.a. |
| NCBI ID | WP_003224994.1 | Uniprot ID | G4NQY6 |
| Organism | Bacillus subtilis subsp. subtilis strain 3NA isolate 1970 (Michel and Millet) | ||
| Function | antagonize RapC (predicted from homology) Competence regulation |
||
Genomic Context
Location: 424961..435083
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| RP72_RS02170 (RP72_02170) | yclJ | 426575..427258 (+) | 684 | WP_003246532.1 | two-component system response regulator YclJ | - |
| RP72_RS02175 (RP72_02175) | yclK | 427245..428666 (+) | 1422 | WP_009969263.1 | two-component system sensor histidine kinase YclK | - |
| RP72_RS02180 (RP72_02180) | rapC | 428829..429977 (+) | 1149 | WP_003246686.1 | response regulator aspartate phosphatase RapC | Regulator |
| RP72_RS02185 (RP72_02185) | phrC | 429961..430083 (+) | 123 | WP_003224994.1 | phosphatase RapC inhibitor PhrC | Regulator |
| RP72_RS22155 (RP72_02190) | yczM | 430183..430272 (-) | 90 | WP_015482794.1 | YjcZ family sporulation protein | - |
| RP72_RS22160 (RP72_02195) | yczN | 430354..430467 (-) | 114 | WP_003234495.1 | YjcZ family sporulation protein | - |
| RP72_RS02200 (RP72_02200) | thrD | 430621..431985 (-) | 1365 | WP_009966541.1 | aspartate kinase | - |
| RP72_RS02205 (RP72_02205) | ceuB | 432370..433320 (+) | 951 | WP_003234491.1 | petrobactin ABC transporter permease YclN | Machinery gene |
| RP72_RS02210 (RP72_02210) | yclO | 433313..434260 (+) | 948 | WP_003246705.1 | petrobactin ABC transporter permease YclO | - |
| RP72_RS02215 (RP72_02215) | yclP | 434254..435012 (+) | 759 | WP_003234487.1 | petrobactin ABC transporter ATP-binding protein YclP | - |
Sequence
Protein
Download Length: 40 a.a. Molecular weight: 4197.98 Da Isoelectric Point: 8.0285
>NTDB_id=136242 RP72_RS02185 WP_003224994.1 429961..430083(+) (phrC) [Bacillus subtilis subsp. subtilis strain 3NA isolate 1970 (Michel and Millet)]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT
Nucleotide
Download Length: 123 bp
>NTDB_id=136242 RP72_RS02185 WP_003224994.1 429961..430083(+) (phrC) [Bacillus subtilis subsp. subtilis strain 3NA isolate 1970 (Michel and Millet)]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| phrC | Bacillus subtilis subsp. subtilis str. 168 |
100 |
100 |
1 |