Detailed information    

experimental Experimentally validated

Overview

Name   rocR   Type   Regulator
Locus tag   - Genome accession   NC_006368
Coordinates   3384456..3384521 (-) Length   22 a.a.
NCBI ID   - Uniprot ID   -
Organism   Legionella pneumophila str. Paris     
Function   repress natural transformation   
Competence regulation

Function

The sRNA rocR is a competence repressor whose function requires the Lpp0148 protein.


Genomic Context

Location: 3379456..3389521
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LPP_RS14945 (lpp2963) - 3380309..3381922 (-) 1614 WP_015961894.1 c-type cytochrome -
  LPP_RS14950 (lpp2964) - 3382304..3382657 (+) 354 WP_015961895.1 Rieske (2Fe-2S) protein -
  LPP_RS14955 (lpp2965) - 3382723..3383751 (+) 1029 WP_015961896.1 glycosyltransferase family 4 protein -
  LPP_RS14960 (lpp2966) - 3383810..3384415 (+) 606 WP_010948586.1 LysE/ArgO family amino acid transporter -
  - rocR 3384456..3384521 (-) 66 - - Regulator
  LPP_RS14965 (lpp2967) - 3384600..3385652 (-) 1053 WP_015961897.1 hypothetical protein -
  LPP_RS14975 (lpp2968) - 3386173..3387123 (+) 951 WP_014844942.1 hypothetical protein -
  LPP_RS14980 (lpp2969) - 3387424..3387849 (+) 426 WP_015961898.1 DUF1841 family protein -
  LPP_RS14985 (lpp2970) ubiE 3387974..3388726 (+) 753 WP_014844943.1 bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE -
  LPP_RS14990 (lpp2971) - 3388734..3389351 (+) 618 WP_015961899.1 ubiquinone biosynthesis accessory factor UbiJ -

Regulatory network

Positive effect      
Negative effect
Regulator Target Regulation
  rocR comEA negative effect
  rocC rocR positive effect
  rocC comEA negative effect

Sequence

Nucleotide


Download         Length: 66 bp        

>NTDB_id=1287 3384456..3384521(-) (rocR) [Legionella pneumophila str. Paris]
GCGAGGTTGGACTTGCTATGTGTCATTCCACTGGGTCAATTGGCGACACACTGATTGGCCCTTTCT

References

[1] Laetitia Attaiech et al. (2016) Silencing of natural transformation by an RNA chaperone and a multitarget small RNA. Proceedings of The National Academy of Sciences of The United States of America 113(31):8813-8. [PMID: 27432973]