Detailed information
Overview
| Name | rocR | Type | Regulator |
| Locus tag | - | Genome accession | NC_006368 |
| Coordinates | 3384456..3384521 (-) | Length | 22 a.a. |
| NCBI ID | - | Uniprot ID | - |
| Organism | Legionella pneumophila str. Paris | ||
| Function | repress natural transformation Competence regulation |
||
Genomic Context
Location: 3379456..3389521
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LPP_RS14945 (lpp2963) | - | 3380309..3381922 (-) | 1614 | WP_015961894.1 | c-type cytochrome | - |
| LPP_RS14950 (lpp2964) | - | 3382304..3382657 (+) | 354 | WP_015961895.1 | Rieske (2Fe-2S) protein | - |
| LPP_RS14955 (lpp2965) | - | 3382723..3383751 (+) | 1029 | WP_015961896.1 | glycosyltransferase family 4 protein | - |
| LPP_RS14960 (lpp2966) | - | 3383810..3384415 (+) | 606 | WP_010948586.1 | LysE/ArgO family amino acid transporter | - |
| - | rocR | 3384456..3384521 (-) | 66 | - | - | Regulator |
| LPP_RS14965 (lpp2967) | - | 3384600..3385652 (-) | 1053 | WP_015961897.1 | hypothetical protein | - |
| LPP_RS14975 (lpp2968) | - | 3386173..3387123 (+) | 951 | WP_014844942.1 | hypothetical protein | - |
| LPP_RS14980 (lpp2969) | - | 3387424..3387849 (+) | 426 | WP_015961898.1 | DUF1841 family protein | - |
| LPP_RS14985 (lpp2970) | ubiE | 3387974..3388726 (+) | 753 | WP_014844943.1 | bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE | - |
| LPP_RS14990 (lpp2971) | - | 3388734..3389351 (+) | 618 | WP_015961899.1 | ubiquinone biosynthesis accessory factor UbiJ | - |
Sequence
Nucleotide
Download Length: 66 bp
>NTDB_id=1287 3384456..3384521(-) (rocR) [Legionella pneumophila str. Paris]
GCGAGGTTGGACTTGCTATGTGTCATTCCACTGGGTCAATTGGCGACACACTGATTGGCCCTTTCT
GCGAGGTTGGACTTGCTATGTGTCATTCCACTGGGTCAATTGGCGACACACTGATTGGCCCTTTCT
References
| [1] | Laetitia Attaiech et al. (2016) Silencing of natural transformation by an RNA chaperone and a multitarget small RNA. Proceedings of The National Academy of Sciences of The United States of America 113(31):8813-8. [PMID: 27432973] |