Detailed information    

experimental Experimentally validated

Overview

Name   rocR   Type   Regulator
Locus tag   - Genome accession   NC_006368
Coordinates   3384456..3384521 (-) Length   22 a.a.
NCBI ID   - Uniprot ID   -
Organism   Legionella pneumophila str. Paris     
Function   repress natural transformation   
Competence regulation

Function

The sRNA rocR is a competence repressor whose function requires the Lpp0148 protein.


Genomic Context

Location: 3379456..3389521
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LPP_RS14945 (lpp2963) - 3380309..3381922 (-) 1614 WP_015961894.1 c-type cytochrome -
  LPP_RS14950 (lpp2964) - 3382304..3382657 (+) 354 WP_015961895.1 Rieske (2Fe-2S) protein -
  LPP_RS14955 (lpp2965) - 3382723..3383751 (+) 1029 WP_015961896.1 glycosyltransferase family 4 protein -
  LPP_RS14960 (lpp2966) - 3383810..3384415 (+) 606 WP_010948586.1 LysE/ArgO family amino acid transporter -
  - rocR 3384456..3384521 (-) 66 - - Regulator
  LPP_RS14965 (lpp2967) - 3384600..3385652 (-) 1053 WP_015961897.1 hypothetical protein -
  LPP_RS14975 (lpp2968) - 3386173..3387123 (+) 951 WP_014844942.1 hypothetical protein -
  LPP_RS14980 (lpp2969) - 3387424..3387849 (+) 426 WP_015961898.1 DUF1841 family protein -
  LPP_RS14985 (lpp2970) ubiE 3387974..3388726 (+) 753 WP_014844943.1 bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE -
  LPP_RS14990 (lpp2971) - 3388734..3389351 (+) 618 WP_015961899.1 SCP2 domain-containing protein -

Regulatory network

Positive effect      
Negative effect
Regulator Target Regulation
  rocR comEA negative effect
  rocC rocR positive effect
  rocC comEA negative effect

Sequence

Protein


Download         Length: 22 a.a.        Molecular weight: Da        Isoelectric Point:

Nucleotide


Download         Length: 66 bp        

>NTDB_id=1287 3384456..3384521(-) (rocR) [Legionella pneumophila str. Paris]
GCGAGGTTGGACTTGCTATGTGTCATTCCACTGGGTCAATTGGCGACACACTGATTGGCCCTTTCT

Domains


No domain identified.



Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value

References

[1] Laetitia Attaiech et al. (2016) Silencing of natural transformation by an RNA chaperone and a multitarget small RNA. Proceedings of The National Academy of Sciences of The United States of America 113(31):8813-8. [PMID: 27432973]