Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   Q433_RS02105 Genome accession   NZ_CP007409
Coordinates   417939..418061 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis str. OH 131.1 strain OH131.1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 412939..423061
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  Q433_RS02090 (Q433_02230) yclJ 414553..415236 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  Q433_RS02095 (Q433_02235) yclK 415223..416644 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  Q433_RS02100 (Q433_02240) rapC 416807..417955 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  Q433_RS02105 (Q433_02245) phrC 417939..418061 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  Q433_RS20960 yczM 418161..418250 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  Q433_RS02115 yczN 418332..418445 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  Q433_RS02120 (Q433_02260) thrD 418598..419962 (-) 1365 WP_029726569.1 aspartate kinase -
  Q433_RS02125 (Q433_02270) ceuB 420347..421297 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  Q433_RS02130 (Q433_02275) yclO 421290..422237 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  Q433_RS02135 (Q433_02280) yclP 422231..422989 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=119187 Q433_RS02105 WP_003224994.1 417939..418061(+) (phrC) [Bacillus subtilis subsp. subtilis str. OH 131.1 strain OH131.1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=119187 Q433_RS02105 WP_003224994.1 417939..418061(+) (phrC) [Bacillus subtilis subsp. subtilis str. OH 131.1 strain OH131.1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment