Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   KJP60_RS02545 Genome accession   NZ_OX419580
Coordinates   478492..478614 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate NRS6116     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 473492..483614
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KJP60_RS02530 (NRS6116_02605) yclJ 475106..475789 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KJP60_RS02535 (NRS6116_02610) yclK 475776..477197 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  KJP60_RS02540 (NRS6116_02615) rapC 477360..478508 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  KJP60_RS02545 (NRS6116_02620) phrC 478492..478614 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KJP60_RS02550 (NRS6116_02625) yczM 478714..478803 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KJP60_RS02555 (NRS6116_02630) yczN 478885..478998 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  KJP60_RS02560 (NRS6116_02635) thrD 479152..480516 (-) 1365 WP_003234493.1 aspartate kinase -
  KJP60_RS02565 (NRS6116_02640) ceuB 480901..481851 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  KJP60_RS02570 (NRS6116_02645) yclO 481844..482791 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  KJP60_RS02575 (NRS6116_02650) yclP 482785..483543 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1157953 KJP60_RS02545 WP_003224994.1 478492..478614(+) (phrC) [Bacillus subtilis isolate NRS6116]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1157953 KJP60_RS02545 WP_003224994.1 478492..478614(+) (phrC) [Bacillus subtilis isolate NRS6116]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment