Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   KJP45_RS02160 Genome accession   NZ_OX419578
Coordinates   424815..424937 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate NRS6128     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 419815..429937
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KJP45_RS02145 (NRS6128_02115) yclJ 421429..422112 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KJP45_RS02150 (NRS6128_02120) yclK 422099..423520 (+) 1422 WP_213414881.1 HAMP domain-containing sensor histidine kinase -
  KJP45_RS02155 (NRS6128_02125) rapC 423683..424831 (+) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  KJP45_RS02160 (NRS6128_02130) phrC 424815..424937 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KJP45_RS02165 (NRS6128_02135) yczM 425037..425126 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KJP45_RS02170 (NRS6128_02140) yczN 425208..425321 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  KJP45_RS02175 (NRS6128_02145) thrD 425475..426839 (-) 1365 WP_033883679.1 aspartate kinase -
  KJP45_RS02180 (NRS6128_02150) ceuB 427224..428174 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  KJP45_RS02185 (NRS6128_02155) yclO 428167..429114 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  KJP45_RS02190 (NRS6128_02160) yclP 429108..429866 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1157796 KJP45_RS02160 WP_003224994.1 424815..424937(+) (phrC) [Bacillus subtilis isolate NRS6128]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1157796 KJP45_RS02160 WP_003224994.1 424815..424937(+) (phrC) [Bacillus subtilis isolate NRS6128]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment