Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   KJP51_RS02165 Genome accession   NZ_OX419576
Coordinates   428584..428706 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate NRS6105     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 423584..433706
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KJP51_RS02150 (NRS6105_02130) yclJ 425198..425881 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KJP51_RS02155 (NRS6105_02135) yclK 425868..427289 (+) 1422 WP_086343454.1 two-component system sensor histidine kinase YclK -
  KJP51_RS02160 (NRS6105_02140) rapC 427452..428600 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  KJP51_RS02165 (NRS6105_02145) phrC 428584..428706 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KJP51_RS02170 (NRS6105_02150) yczM 428806..428895 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KJP51_RS02175 (NRS6105_02155) yczN 428977..429090 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  KJP51_RS02180 (NRS6105_02160) thrD 429243..430607 (-) 1365 WP_086343456.1 aspartate kinase -
  KJP51_RS02185 (NRS6105_02165) ceuB 430992..431942 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  KJP51_RS02190 (NRS6105_02170) yclO 431935..432882 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  KJP51_RS02195 (NRS6105_02175) yclP 432876..433634 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1157637 KJP51_RS02165 WP_003224994.1 428584..428706(+) (phrC) [Bacillus subtilis isolate NRS6105]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1157637 KJP51_RS02165 WP_003224994.1 428584..428706(+) (phrC) [Bacillus subtilis isolate NRS6105]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment