Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   KJP57_RS02555 Genome accession   NZ_OX419573
Coordinates   480160..480282 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate NRS6085     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 475160..485282
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KJP57_RS02540 (NRS6085_02545) yclJ 476774..477457 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KJP57_RS02545 (NRS6085_02550) yclK 477444..478865 (+) 1422 WP_213407897.1 HAMP domain-containing sensor histidine kinase -
  KJP57_RS02550 (NRS6085_02555) rapC 479028..480176 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  KJP57_RS02555 (NRS6085_02560) phrC 480160..480282 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KJP57_RS02560 (NRS6085_02565) yczM 480382..480471 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KJP57_RS02565 (NRS6085_02570) yczN 480553..480666 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  KJP57_RS02570 (NRS6085_02575) thrD 480820..482184 (-) 1365 WP_213407896.1 aspartate kinase -
  KJP57_RS02575 (NRS6085_02580) ceuB 482569..483519 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  KJP57_RS02580 (NRS6085_02585) yclO 483512..484459 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  KJP57_RS02585 (NRS6085_02590) yclP 484453..485211 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1157471 KJP57_RS02555 WP_003224994.1 480160..480282(+) (phrC) [Bacillus subtilis isolate NRS6085]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1157471 KJP57_RS02555 WP_003224994.1 480160..480282(+) (phrC) [Bacillus subtilis isolate NRS6085]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment