Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   KJP64_RS02155 Genome accession   NZ_OX419565
Coordinates   423582..423704 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate NRS6145     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 418582..428704
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KJP64_RS02140 (NRS6145_02115) yclJ 420196..420879 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KJP64_RS02145 (NRS6145_02120) yclK 420866..422287 (+) 1422 WP_086343454.1 two-component system sensor histidine kinase YclK -
  KJP64_RS02150 (NRS6145_02125) rapC 422450..423598 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  KJP64_RS02155 (NRS6145_02130) phrC 423582..423704 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KJP64_RS02160 (NRS6145_02135) yczM 423804..423893 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KJP64_RS02165 (NRS6145_02140) yczN 423975..424088 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  KJP64_RS02170 (NRS6145_02145) thrD 424241..425605 (-) 1365 WP_086343456.1 aspartate kinase -
  KJP64_RS02175 (NRS6145_02150) ceuB 425990..426940 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  KJP64_RS02180 (NRS6145_02155) yclO 426933..427880 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  KJP64_RS02185 (NRS6145_02160) yclP 427874..428632 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1157129 KJP64_RS02155 WP_003224994.1 423582..423704(+) (phrC) [Bacillus subtilis isolate NRS6145]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1157129 KJP64_RS02155 WP_003224994.1 423582..423704(+) (phrC) [Bacillus subtilis isolate NRS6145]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment