Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   KJP48_RS02165 Genome accession   NZ_OX419564
Coordinates   428281..428403 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate NRS6127     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 423281..433403
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KJP48_RS02150 (NRS6127_02120) yclJ 424895..425578 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KJP48_RS02155 (NRS6127_02125) yclK 425565..426986 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  KJP48_RS02160 (NRS6127_02130) rapC 427149..428297 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  KJP48_RS02165 (NRS6127_02135) phrC 428281..428403 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KJP48_RS02170 (NRS6127_02140) yczM 428503..428592 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KJP48_RS02175 (NRS6127_02145) yczN 428674..428787 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  KJP48_RS02180 (NRS6127_02150) thrD 428940..430304 (-) 1365 WP_029726569.1 aspartate kinase -
  KJP48_RS02185 (NRS6127_02155) ceuB 430689..431639 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  KJP48_RS02190 (NRS6127_02160) yclO 431632..432579 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  KJP48_RS02195 (NRS6127_02165) yclP 432573..433331 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1157050 KJP48_RS02165 WP_003224994.1 428281..428403(+) (phrC) [Bacillus subtilis isolate NRS6127]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1157050 KJP48_RS02165 WP_003224994.1 428281..428403(+) (phrC) [Bacillus subtilis isolate NRS6127]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment