Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   KJP65_RS02165 Genome accession   NZ_OX419555
Coordinates   428062..428184 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate NRS6181     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 423062..433184
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KJP65_RS02150 (NRS6181_02120) yclJ 424676..425359 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KJP65_RS02155 (NRS6181_02125) yclK 425346..426767 (+) 1422 WP_113713032.1 two-component system sensor histidine kinase YclK -
  KJP65_RS02160 (NRS6181_02130) rapC 426930..428078 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  KJP65_RS02165 (NRS6181_02135) phrC 428062..428184 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KJP65_RS02170 (NRS6181_02140) yczM 428284..428373 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KJP65_RS02175 (NRS6181_02145) yczN 428455..428568 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  KJP65_RS02180 (NRS6181_02150) thrD 428722..430086 (-) 1365 WP_113713033.1 aspartate kinase -
  KJP65_RS02185 (NRS6181_02155) ceuB 430471..431421 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  KJP65_RS02190 (NRS6181_02160) yclO 431414..432361 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  KJP65_RS02195 (NRS6181_02165) yclP 432355..433113 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1156648 KJP65_RS02165 WP_003224994.1 428062..428184(+) (phrC) [Bacillus subtilis isolate NRS6181]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1156648 KJP65_RS02165 WP_003224994.1 428062..428184(+) (phrC) [Bacillus subtilis isolate NRS6181]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment