Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   KJP77_RS02520 Genome accession   NZ_OX419554
Coordinates   477296..477418 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate NRS6160     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 472296..482418
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KJP77_RS02505 (NRS6160_02480) yclJ 473910..474593 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KJP77_RS02510 (NRS6160_02485) yclK 474580..476001 (+) 1422 WP_074794501.1 two-component system sensor histidine kinase YclK -
  KJP77_RS02515 (NRS6160_02490) rapC 476164..477312 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  KJP77_RS02520 (NRS6160_02495) phrC 477296..477418 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KJP77_RS02525 (NRS6160_02500) yczM 477518..477607 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KJP77_RS02530 (NRS6160_02505) yczN 477689..477802 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  KJP77_RS02535 (NRS6160_02510) thrD 477955..479319 (-) 1365 WP_015715246.1 aspartate kinase -
  KJP77_RS02540 (NRS6160_02515) ceuB 479704..480654 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  KJP77_RS02545 (NRS6160_02520) yclO 480647..481594 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  KJP77_RS02550 (NRS6160_02525) yclP 481588..482346 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1156569 KJP77_RS02520 WP_003224994.1 477296..477418(+) (phrC) [Bacillus subtilis isolate NRS6160]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1156569 KJP77_RS02520 WP_003224994.1 477296..477418(+) (phrC) [Bacillus subtilis isolate NRS6160]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment