Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   VV34_RS02185 Genome accession   NZ_LN649259
Coordinates   429948..430070 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain BS49     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424948..435070
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  VV34_RS02170 (BS49_04320) yclJ 426562..427245 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  VV34_RS02175 (BS49_04330) yclK 427232..428653 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  VV34_RS02180 (BS49_04340) rapC 428816..429964 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  VV34_RS02185 (BS49_04350) phrC 429948..430070 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  VV34_RS22425 yczM 430170..430259 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  VV34_RS22430 (BS49_04360) yczN 430341..430454 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  VV34_RS02200 (BS49_04370) thrD 430608..431972 (-) 1365 WP_009966541.1 aspartate kinase -
  VV34_RS02205 (BS49_04380) ceuB 432357..433307 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  VV34_RS02210 (BS49_04390) yclO 433300..434247 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  VV34_RS02215 (BS49_04400) yclP 434241..434999 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1113748 VV34_RS02185 WP_003224994.1 429948..430070(+) (phrC) [Bacillus subtilis strain BS49]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1113748 VV34_RS02185 WP_003224994.1 429948..430070(+) (phrC) [Bacillus subtilis strain BS49]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment