Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ACLQ7P_RS02155 Genome accession   NZ_CP181322
Coordinates   423938..424060 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain JCK-1398     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 418938..429060
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACLQ7P_RS02140 (ACLQ7P_02140) yclJ 420551..421234 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ACLQ7P_RS02145 (ACLQ7P_02145) yclK 421221..422642 (+) 1422 WP_080317125.1 two-component system sensor histidine kinase YclK -
  ACLQ7P_RS02150 (ACLQ7P_02150) rapC 422806..423954 (+) 1149 WP_416247312.1 response regulator aspartate phosphatase RapC Regulator
  ACLQ7P_RS02155 (ACLQ7P_02155) phrC 423938..424060 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACLQ7P_RS02160 (ACLQ7P_02160) yczM 424160..424249 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACLQ7P_RS02165 (ACLQ7P_02165) yczN 424331..424444 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  ACLQ7P_RS02170 (ACLQ7P_02170) thrD 424597..425961 (-) 1365 WP_416247313.1 aspartate kinase -
  ACLQ7P_RS02175 (ACLQ7P_02175) ceuB 426352..427302 (+) 951 WP_087960839.1 petrobactin ABC transporter permease YclN Machinery gene
  ACLQ7P_RS02180 (ACLQ7P_02180) yclO 427295..428242 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ACLQ7P_RS02185 (ACLQ7P_02185) yclP 428236..428988 (+) 753 WP_416247314.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1099674 ACLQ7P_RS02155 WP_003224994.1 423938..424060(+) (phrC) [Bacillus subtilis subsp. subtilis strain JCK-1398]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1099674 ACLQ7P_RS02155 WP_003224994.1 423938..424060(+) (phrC) [Bacillus subtilis subsp. subtilis strain JCK-1398]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment