Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACK2OW_RS18095 Genome accession   NZ_CP180575
Coordinates   3479649..3479771 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain K3C     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3474649..3484771
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACK2OW_RS18080 (ACK2OW_18080) yclJ 3476263..3476946 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  ACK2OW_RS18085 (ACK2OW_18085) yclK 3476933..3478354 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  ACK2OW_RS18090 (ACK2OW_18090) rapC 3478517..3479665 (+) 1149 WP_342412087.1 response regulator aspartate phosphatase RapC Regulator
  ACK2OW_RS18095 (ACK2OW_18095) phrC 3479649..3479771 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACK2OW_RS18100 (ACK2OW_18100) yczM 3479871..3479960 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACK2OW_RS18105 (ACK2OW_18105) yczN 3480042..3480155 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  ACK2OW_RS18110 (ACK2OW_18110) thrD 3480308..3481672 (-) 1365 WP_416042389.1 aspartate kinase -
  ACK2OW_RS18115 (ACK2OW_18115) ceuB 3482057..3483007 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ACK2OW_RS18120 (ACK2OW_18120) yclO 3483000..3483947 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ACK2OW_RS18125 (ACK2OW_18125) yclP 3483941..3484699 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1096808 ACK2OW_RS18095 WP_003224994.1 3479649..3479771(+) (phrC) [Bacillus subtilis strain K3C]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1096808 ACK2OW_RS18095 WP_003224994.1 3479649..3479771(+) (phrC) [Bacillus subtilis strain K3C]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
AGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment