Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACMX8W_RS02125 Genome accession   NZ_CP180439
Coordinates   420465..420587 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain Z-294     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 415465..425587
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACMX8W_RS02110 (ACMX8W_02110) yclJ 417078..417761 (+) 684 WP_063336130.1 two-component system response regulator YclJ -
  ACMX8W_RS02115 (ACMX8W_02115) yclK 417748..419169 (+) 1422 WP_080467384.1 two-component system sensor histidine kinase YclK -
  ACMX8W_RS02120 (ACMX8W_02120) rapC 419333..420481 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  ACMX8W_RS02125 (ACMX8W_02125) phrC 420465..420587 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACMX8W_RS02130 (ACMX8W_02130) yczM 420687..420776 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACMX8W_RS02135 (ACMX8W_02135) yczN 420858..420971 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  ACMX8W_RS02140 (ACMX8W_02140) thrD 421124..422488 (-) 1365 WP_063336058.1 aspartate kinase -
  ACMX8W_RS02145 (ACMX8W_02145) ceuB 422873..423823 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  ACMX8W_RS02150 (ACMX8W_02150) yclO 423816..424763 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  ACMX8W_RS02155 (ACMX8W_02155) yclP 424757..425515 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1095847 ACMX8W_RS02125 WP_003224994.1 420465..420587(+) (phrC) [Bacillus subtilis strain Z-294]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1095847 ACMX8W_RS02125 WP_003224994.1 420465..420587(+) (phrC) [Bacillus subtilis strain Z-294]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment