Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACL6EQ_RS01240 Genome accession   NZ_CP178716
Coordinates   269748..269870 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SY1483     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 264748..274870
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACL6EQ_RS01225 (ACL6EQ_01225) yclJ 266361..267044 (+) 684 WP_413359832.1 two-component system response regulator YclJ -
  ACL6EQ_RS01230 (ACL6EQ_01230) yclK 267031..268452 (+) 1422 WP_086343454.1 two-component system sensor histidine kinase YclK -
  ACL6EQ_RS01235 (ACL6EQ_01235) rapC 268616..269764 (+) 1149 WP_077671292.1 response regulator aspartate phosphatase RapC Regulator
  ACL6EQ_RS01240 (ACL6EQ_01240) phrC 269748..269870 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACL6EQ_RS01245 (ACL6EQ_01245) yczM 269968..270057 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACL6EQ_RS01250 (ACL6EQ_01250) yczN 270139..270252 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  ACL6EQ_RS01255 (ACL6EQ_01255) thrD 270405..271769 (-) 1365 WP_024571685.1 aspartate kinase -
  ACL6EQ_RS01260 (ACL6EQ_01260) ceuB 272154..273104 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ACL6EQ_RS01265 (ACL6EQ_01265) yclO 273097..274044 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ACL6EQ_RS01270 (ACL6EQ_01270) yclP 274038..274796 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1090737 ACL6EQ_RS01240 WP_003224994.1 269748..269870(+) (phrC) [Bacillus subtilis strain SY1483]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1090737 ACL6EQ_RS01240 WP_003224994.1 269748..269870(+) (phrC) [Bacillus subtilis strain SY1483]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment