Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACL66B_RS02120 Genome accession   NZ_CP178617
Coordinates   421452..421574 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain QXKL-3     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 416452..426574
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACL66B_RS02105 (ACL66B_02105) yclJ 418065..418748 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ACL66B_RS02110 (ACL66B_02110) yclK 418735..420156 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  ACL66B_RS02115 (ACL66B_02115) rapC 420320..421468 (+) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  ACL66B_RS02120 (ACL66B_02120) phrC 421452..421574 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACL66B_RS02125 (ACL66B_02125) yczM 421676..421765 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACL66B_RS02130 (ACL66B_02130) yczN 421847..421960 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ACL66B_RS02135 (ACL66B_02135) thrD 422114..423478 (-) 1365 WP_043940054.1 aspartate kinase -
  ACL66B_RS02140 (ACL66B_02140) ceuB 423863..424813 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ACL66B_RS02145 (ACL66B_02145) yclO 424806..425753 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ACL66B_RS02150 (ACL66B_02150) yclP 425747..426505 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1090531 ACL66B_RS02120 WP_003224994.1 421452..421574(+) (phrC) [Bacillus subtilis strain QXKL-3]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1090531 ACL66B_RS02120 WP_003224994.1 421452..421574(+) (phrC) [Bacillus subtilis strain QXKL-3]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment