Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACLF6N_RS02160 Genome accession   NZ_CP177279
Coordinates   429354..429476 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain KFRI-P74     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424354..434476
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACLF6N_RS02145 (ACLF6N_02145) yclJ 425967..426650 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ACLF6N_RS02150 (ACLF6N_02150) yclK 426637..428058 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  ACLF6N_RS02155 (ACLF6N_02155) rapC 428222..429370 (+) 1149 WP_069837255.1 response regulator aspartate phosphatase RapC Regulator
  ACLF6N_RS02160 (ACLF6N_02160) phrC 429354..429476 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACLF6N_RS02165 (ACLF6N_02165) yczM 429575..429664 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACLF6N_RS02170 (ACLF6N_02170) yczN 429746..429859 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  ACLF6N_RS02175 (ACLF6N_02175) thrD 430012..431376 (-) 1365 WP_021481755.1 aspartate kinase -
  ACLF6N_RS02180 (ACLF6N_02180) ceuB 431767..432717 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ACLF6N_RS02185 (ACLF6N_02185) yclO 432710..433657 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  ACLF6N_RS02190 (ACLF6N_02190) yclP 433651..434409 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1086516 ACLF6N_RS02160 WP_003224994.1 429354..429476(+) (phrC) [Bacillus subtilis strain KFRI-P74]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1086516 ACLF6N_RS02160 WP_003224994.1 429354..429476(+) (phrC) [Bacillus subtilis strain KFRI-P74]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment