Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACJED3_RS09700 Genome accession   NZ_CP174155
Coordinates   1789254..1789376 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain G01     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1784254..1794376
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACJED3_RS09670 yclP 1784321..1785079 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  ACJED3_RS09675 yclO 1785073..1786020 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  ACJED3_RS09680 ceuB 1786013..1786963 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ACJED3_RS09685 thrD 1787354..1788718 (+) 1365 WP_014478832.1 aspartate kinase -
  ACJED3_RS09690 yczN 1788871..1788984 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  ACJED3_RS09695 yczM 1789066..1789155 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACJED3_RS09700 phrC 1789254..1789376 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACJED3_RS09705 rapC 1789360..1790508 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  ACJED3_RS09710 yclK 1790671..1792092 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  ACJED3_RS09715 yclJ 1792079..1792762 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1074585 ACJED3_RS09700 WP_003224994.1 1789254..1789376(-) (phrC) [Bacillus subtilis strain G01]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1074585 ACJED3_RS09700 WP_003224994.1 1789254..1789376(-) (phrC) [Bacillus subtilis strain G01]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment