Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACI2O8_RS02525 Genome accession   NZ_CP173415
Coordinates   482786..482908 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain FJYA24     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 477786..487908
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACI2O8_RS02510 (ACI2O8_02510) yclJ 479400..480083 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ACI2O8_RS02515 (ACI2O8_02515) yclK 480070..481491 (+) 1422 WP_113713032.1 two-component system sensor histidine kinase YclK -
  ACI2O8_RS02520 (ACI2O8_02520) rapC 481654..482802 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  ACI2O8_RS02525 (ACI2O8_02525) phrC 482786..482908 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACI2O8_RS02530 (ACI2O8_02530) yczM 483008..483097 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACI2O8_RS02535 (ACI2O8_02535) yczN 483179..483292 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ACI2O8_RS02540 (ACI2O8_02540) thrD 483446..484810 (-) 1365 WP_113713033.1 aspartate kinase -
  ACI2O8_RS02545 (ACI2O8_02545) ceuB 485195..486145 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ACI2O8_RS02550 (ACI2O8_02550) yclO 486138..487085 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ACI2O8_RS02555 (ACI2O8_02555) yclP 487079..487837 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1072072 ACI2O8_RS02525 WP_003224994.1 482786..482908(+) (phrC) [Bacillus subtilis strain FJYA24]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1072072 ACI2O8_RS02525 WP_003224994.1 482786..482908(+) (phrC) [Bacillus subtilis strain FJYA24]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment