Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACFVP7_RS02220 Genome accession   NZ_CP172606
Coordinates   437780..437902 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. SG20033     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 432780..442902
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACFVP7_RS02205 (ACFVP7_02205) yclJ 434394..435077 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ACFVP7_RS02210 (ACFVP7_02210) yclK 435064..436485 (+) 1422 WP_086343454.1 two-component system sensor histidine kinase YclK -
  ACFVP7_RS02215 (ACFVP7_02215) rapC 436648..437796 (+) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  ACFVP7_RS02220 (ACFVP7_02220) phrC 437780..437902 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACFVP7_RS02225 (ACFVP7_02225) - 438000..438089 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACFVP7_RS02230 (ACFVP7_02230) - 438171..438284 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ACFVP7_RS02235 (ACFVP7_02235) - 438437..439801 (-) 1365 WP_396582953.1 aspartate kinase -
  ACFVP7_RS02240 (ACFVP7_02240) ceuB 440186..441136 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ACFVP7_RS02245 (ACFVP7_02245) yclO 441129..442076 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  ACFVP7_RS02250 (ACFVP7_02250) yclP 442070..442828 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1068273 ACFVP7_RS02220 WP_003224994.1 437780..437902(+) (phrC) [Bacillus sp. SG20033]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1068273 ACFVP7_RS02220 WP_003224994.1 437780..437902(+) (phrC) [Bacillus sp. SG20033]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment