Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   KJP47_RS02210 Genome accession   NZ_OX419577
Coordinates   438233..438355 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate NRS6120     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 433233..443355
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KJP47_RS02195 (NRS6120_02325) yclJ 434846..435529 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KJP47_RS02200 (NRS6120_02330) yclK 435516..436937 (+) 1422 WP_213382651.1 HAMP domain-containing sensor histidine kinase -
  KJP47_RS02205 (NRS6120_02335) rapC 437101..438249 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  KJP47_RS02210 (NRS6120_02340) phrC 438233..438355 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KJP47_RS02215 (NRS6120_02345) yczM 438455..438544 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KJP47_RS02220 (NRS6120_02350) yczN 438626..438739 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  KJP47_RS02225 (NRS6120_02355) thrD 438892..440256 (-) 1365 WP_213382649.1 aspartate kinase -
  KJP47_RS02230 (NRS6120_02360) ceuB 440641..441591 (+) 951 WP_213382643.1 ABC transporter permease Machinery gene
  KJP47_RS02235 (NRS6120_02365) yclO 441584..442531 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  KJP47_RS02240 (NRS6120_02370) yclP 442525..443283 (+) 759 WP_213382642.1 ABC transporter ATP-binding protein -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1041014 KJP47_RS02210 WP_003224994.1 438233..438355(+) (phrC) [Bacillus subtilis isolate NRS6120]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1041014 KJP47_RS02210 WP_003224994.1 438233..438355(+) (phrC) [Bacillus subtilis isolate NRS6120]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1